Cell Division and Pathogens Pathobiology 552 Denise Galloway [email protected] The Cell Cycle Growth arrest vs. apoptosis Telomeres and telomerase Human papillomaviruses and the cell cycle Immortalization and transformation M- phase Segregation of chromosomes G2-phase Gap 2 G1-phase Gap 1
S phase Replication of DNA CYC D CDK 4 M G2 CYC B CDC 2 G1 S CYC A CDC 2 CYC E CDK 2
CYC A CDK 2 Transcription Binding of inhibitor Degradation (PEST, D-box) Cyclin CKI P - T14 Y15 Wee1/Myt-1 kinase CKI CD Kinase Cks
CDC25 phosphatase Binding of cyclin to CDK T161 - P CAK (CDK activating kinase) Control of G1/S Transition p16INK4A (p15, p18, p19) CYC D CDK4
Rb/p107/p130 CYC E CDK2 p21CIP1 (p27, p57) p53 ARF E2F HDAC HDAC HAT Ac
Ac X Ac Ac AcAc Ac Ac M G2 DNA Damage G1 p53
S p53 ATM/p53 Signaling Pathway ATM/p53 Signaling Pathway ATM Chk2 CDK2 p53 G1 arrest E p21 CDC2 B
G2 arrest S/M Re-rep. G1 S G1/S S G2 M G2/M Spindle G2/M
Oncogenes, DNA damage Hypoxia Redox kinases Growth factors ARF p53 MDM2 p21 Apoptosis
Growth arrest Pathogen infection stimulates apoptosis Why do cells need telomeres and telomerase? Linear chromosomes pose 2 problems for cells: 1. End-replication problem 2. Distinguishing chromosome ends from ds DNA breaks The end-replication problem DNA replication 5 leading strand lagging strand 3
RNA primer removal and Okazaki fragment ligation 5 3 Telomeres are protein/DNA protective structures at the ends of chromosomes telomeres telomeres 3 G-strand overhang ~ 10 Kb human ~ 40 Kb mouse TTAGGG AATCCC
Q-FISH to detect TTAGGG (PNA probes) TTAGGG AATCCC Telomere-binding proteins Rad50/Mre11/Nbs1 pot-1 tankyrase TRF1 PARP5 open telomere Ku Ku
tin2 telomerase Ku TRF2 DNA-PKcs TRF2 DNA-PKcs TRF1 closed telomere t-loop Telomere structure caps chromosome ends
Griffith 1999 G strand T-loop 5 hPOT1 3 TRF2 C strand TRF1 nucleosomes zoom in on telomere adapted from Neidle and Parkinson (2003) Current Opinion in Structural Biology Telomeres and telomerase
3 Telomerase hTERT hTR CCCAATCCCAATCCC5 AAUCCCAA GGGTTAGGGTTAGGGTTAGGGTTAGGGTT3 10-15 Kb ds telomeric DNA ~200 nt ss 3 overhang Regulation of telomerase expression Primarily by regulating expression of the hTERT catalytic subunit hTERT AAUCCCAA
The hTERT and hTR components are sufficient for in vitro activity. Kilian 1997, Meyerson 1997, Nakamura 1997 Expression of hTERT subunit is sufficient to induce telomerase activity in many different cell types. Bodnar 1998, Counter 1998, Vaziri and Benchimol 1998 While most somatic cells do not express hTERT, stem cells, germ cells, and tumor cells DO express hTERT. Kim 1994, Sharma 1995, Chiu 1996, Kolquist 1998 Regulation of hTERT expression Ac Ac Ac Ac Ac Ac
Ac Ac Ac Ac Ac Ac Ac Ac CpG Island Ac Ac TSA treatment to inhibit histone deacetylases induces Noincorrelation of DNA methylation with telomerase activity some cell types transcriptional
Cong 2000, Takakura 2001, Hou 2002activity of the promoter Chromatin modifications may play a key role in activity DNA Tumor Virus Oncoproteins SV40 Large T antigen Small T Ad pp2A E1A Rb E1B HPV
Rb, p53 E6 p53 p53, hTert E7 Rb The human papillomavirus Viral oncogenes LCR E6 E7
HPV L1 E1 ~8000 bp Viral capsid proteins E2 L2 E5 E4 Transcriptional control and viral
DNA replication Expression of viral genes in the stratified epithelium Virus release Late gene expression and capsid formation
Squamous Early gene expression and viral DNA replication Suprabasal HPV infects basal cells Basal Infected epithelium
Normal epithelium Basement membrane RB p107, p130 E2F Ub. RB p107, p130 E7 E2F
RB Mi-2 p21, p107, p130 p27 E7 TBP M2 Acid PK -gluc S4 ATPase c-jun, junB, junD, c-fos Ub Ub E6-AP
(E3 Ub. ligase) p53 E6 CBP/p300 ERC55 pax. GAP hScribble tyk2 MAGI E6 hDLG IRF3 Mupp1 Activates transcription MCM7 bax bak Represses transcription PKN Activates telomerase in epithelial cells
Targets of the E6 and E7 oncoproteins E7 E6 Rb E6-AP E2F S phase genes induces E6 p53 AAUCCCAA
telomerase activity E2F S phase genes Regulation of the G1/S transition p16INK4A (p15, p18, p19) CYC D CDK4 E7 PcG CYC E CDK2
p21CIP1 (p27, p57) Rb/p107/p130 HDAC E2F E6 p53 MDM2 ARF ? Working Model for regulation of the hTERT Promoter in Normal HFKs E
NFX1 -91 Myc Max Sin3A E X HDAC TERT Working Model for E6 Activation of hTERT ? Ac
? HAT Ac Myc Max NFX1-123 HAT Myc Max ? E Ac
Ac TERT E X Ac Ac E6 NFX1-91 E6AP Ac Ac HPV-16 E6 and E7 can efficiently immortalize epithelial cells
Population doublings + E6 + E7 + E6 or E7 Senescence Days in culture Induction of telomerase and loss of Rb/p16 pathway are required for immortalization of epithelial cells Population doublings + Telomerase AND Loss of Rb/p16 + Telomerase OR Loss of Rb/p16 Senescence
Days in culture HPV E7 Inactivation of Rb/p16/cyclin D HPV E6 Inactivation of p53/p21/ATM Block apoptosis Activation of telomerase Activation of genes for invasion, metastasis, angiogenesis
